189
ISSN Versión impresa: 1992-2159; ISSN Versión electrónica: 2519-5697
Biotempo, 2017, 14(2), jul-dec.: 189-196.
Biotempo (Lima)
ORIGINAL ARTICLE / ARTÍCULO ORIGINAL
PLASMID DESING FOR THE EXPRESSION OF CYND IN ARABIDOPSIS
THALIANA VIA AGROBACTERIUM TUMEFACIENS
DISEÑO DE PLÁSMIDOS PARA LA EXPRESIÓN DEL CYND EN
ARABIDOPSIS THALIANA VÍA AGROBACTERIUM TUMEFACIENS
Andrea Cuba1; Miguel Montero1; Bryan Canal1; Claudia De los Ríos1 & Roberto Pineda1
1 Laboratorio de Computo Avanzado de la Facultad de Ciencias Biológicas, Grupo de Bioinformática y Sistemas Complejos,
Universidad Ricardo Palma, Lima, Perú.
ABSTRACT
Cyanide, used by the mining industries, is a toxic compound which mainly a ects c-oxidase metalloenzyme in living
beings, an essential enzyme for cellular respiration. e inhibition of this enzyme blocks oxidative phosphorylation,
causing cell death. Biological methods such as phytoremediation provide an alternative to reduce or degrade contaminants
such as cyanide. However, this technique would require plants that tolerate high concentrations of the metal present in
the soil. On the other hand, some microorganisms have a high capacity of cyanide detoxi cation due to many metabolic
pathways they have, such as Bacillus pumilus Meyer and Gottheil 1901, which presents the cyanid CynD that allows
the degradation of cyanide formic acid and ammonium. e aim of this research was to design plasmids for the CynD
expression in a model plant such as Arabidopsis thaliana (L.), Heynh. via Agrobacterium tumefaciens (Smith & Townsend,
1907) Conn, 1942 to lay the foundations to evaluate if the CynD of B. pumilus could confer to the plants the ability
to grow in the presence of cyanide and assist in its degradation. For this purpose, bioinformatic tools were used to
design a cloning vector (pUCCynD), inserting in silico the CynD sequence in the polylinker of the plasmid pUC18,
among the EcoRi (5’GAATTC - 3’CTTAAG) and BamHi (5’GGATCC-3’CCTAGG) enzymes; and a transformation
vector (pBCynD), inserting in silico the CynD sequence into the polylinker of the plasmid pBI121, among the ScaI
(5’GAGCTC-3 ‘CTCGAG) and BamHI (5’GGATCC-3’CCTAGG) enzymes.
Keywords: Agrobacterium tumefaciens – Cyanide – CynD – genetic transformation
RESUMEN
El cianuro, usado por las industrias mineras, es un compuesto tóxico que afecta principalmente a la metaloenzima c
oxidasa en los seres vivos, enzima esencial para la respiración celular; por lo que la inhibición de esta enzima bloquea
la fosforilación oxidativa, provocando la muerte celular. Ante ello, métodos biológicos como la torremediación
proporcionan una alternativa para reducir o degradar contaminantes como el cianuro; sin embargo, esta técnica requeriría
plantas que toleren altas concentraciones del metal en el suelo. Por otro lado, algunos microorganismos tienen una alta
capacidad de desintoxicación de cianuro debido a una serie de vías metabólicas, como es el caso del Bacillus pumilus
Meyer and Gottheil 1901, que presenta la cianidasa CynD que permite la degradación del cianuro a ácido fórmico y
LIMA - PERÚ
Revista Biotempo: ISSN Versión Impresa: 1992-2159; ISSN Versión electrónica: 2519-5697 Cuba et al.
190
INTRODUCTION
e growing interest in the exploitation of gold by
various mining companies stems from increases in
gold prices that provide a high prot margin and
from the recent creation of cost-eective methods of
production, such the extraction of gold in extremely
poor deposits thanks to the technology of extraction
by leaching with cyanide.
is technology has replaced the recovery of gold by
amalgamation with mercury, since it allows a recovery
of 97% of the mineral, compared to the 60% that
mercury allows (Vargas, 2017). is ability of cyanide
is due to its property of complexing with heavy metals.
e free cyanide comprises the hydrocyanic acid gas
(HCN) and the cyanide ion (CN-) present in solution,
but only the CN has the capacity to form complexes
with dierent metal ions, for this reason this ion is
used in industrial applications (Vargas, 2017; Donato
et al., 2007).
However, free cyanide (HCN and CN-) is extremely
toxic. It mainly aects the metalloenzyme cytochrome
c oxidase in living beings, an essential enzyme for
cellular respiration. erefore, the inhibition of this
enzyme blocks oxidative phosphorylation, decreasing
ATP concentration in the cell and causing cell death
(Donato et al., 2007). Cyanide may also inhibit the
activity of at least 13 other enzymes, such as catalase,
peroxidase, phosphatase, ribulose-1,5-bisphosphate,
etc. (Vasil’ev et al., 2007).
Considering that, biological methods such as
phytoremediation provide an alternative to reduce
or degrade contaminants such as cyanide. However,
this technique would require plants that tolerate high
concentrations of the metal in the soil.
Although plants have enzymes such as β-cyanoalanine
synthase, to prevent their self-poisoning with cyanide
they produce from hydrolysis of cyanogenic glycosides
and as a by-product of ethylene biosynthesis, these
enzymes only detoxify limited concentrations of
exogenous cyanide (Logan et al., 2000; Molojwane,
2015). is causes that on exposure to relatively
low concentrations of exogenous cyanide, they die
(Kebeish et al., 2015; Molojwane, 2015). In contrast,
some microorganisms have a high capacity for cyanide
detoxication due to their many metabolic pathways
(Gong et al., 2012; Molojwane, 2015) such as Bacillus
pumilus Meyer & Gottheil 1901, which presents the
CynD cyanidase that allows the degradation of cyanide
to formic acid and ammonium.
erefore, if we want to apply techniques such as
phytoremediation it is necessary to obtain plants that
have resistance to high concentrations of cyanide and
be able to use and degrade it (Molojwane, 2015). is
is why we are working on the insertion of bacterial
genes associated with the degradation of toxic tailings,
such as cyanide, in a model plant: A. thaliana.
Genetic transformation of bacteria, is a laboratory
procedure by which genetic material is introduced into
a bacterium. Generally, the inserted genetic material
is known as plasmid (circular DNA), but other forms
of genetic material, such as DNA or RNA, may be
inserted. e transformation has many applications,
such as the production of proteins, the production of
the same plasmids, the production of remedial bacteria,
among others.
e plasmids used for the transformation of bacteria
generally contain one or several genes of interest, a
reporter gene and an antibiotic resistance gene, which
enables the selection of the transformed bacteria from
others by their ability to grow in medium containing
the antibiotic resistance (Echenique, 2004).
amonio. Por ello, el presente trabajo tiene como objetivo el diseño de plásmidos para la expresión de CynD en una planta
modelo como la Arabidopsis thaliana (L.), Heynh. vía Agrobacterium tumefaciens (Smith & Townsend, 1907) Conn, 1942
con el n de sentar las bases para evaluar si el CynD de B. pumilus le podría conferir a las plantas la facultad de crecer en
presencia de cianuro y ayudar a su degradación. Para lo cual, se hizo uso de herramientas de la bioinformática, logrando
diseñar un vector de clonación (pUCCynD), insertando in silico la secuencia del CynD en el polilinker del plásmido
pUC18, entre las enzimas EcoRi (5’GAATTC - 3’CTTAAG) y BamHi (5’GGATCC-3’CCTAGG) del sitio múltiple de
restricción y también un vector de transformación (pBCynD), insertando in silico la secuencia del CynD en el polilinker
del plásmido pBI121, entre las enzimas ScaI (5’GAGCTC - 3’CTCGAG) y BamHI (5’GGATCC - 3’CCTAGG).
Palabras clave: Agrobacterium tumefaciens – Cianuro – CynD – transformación genética
Plasmid design for the expression of cynd in Arabidopsis
191
e design of vectors for the genetic transformation
of plants by the use of Agrobacterium species is widely
used because only the T-DNA edge sequences are
required for the transfer to take place (Garnkel et
al., 1981; Zambryski et al.,1983). Some or all of the
T-DNA bacterial genes can be removed by giving rise
to unarmed vectors, which can transform plant cells
without the general symptoms of bacterial infection.
During the infection process, Agrobacterium
tumefaciens (Smith & Townsend, 1907) Conn, 1942
introduces into the plant cell a part of its DNA
(transfer DNA) which is integrated into the genome
of the plant (Binns & Campbell, 2001; Valderrama
et al., 2005; Rodríguez, 2012). T-DNA genes are
expressed in their host and induce the formation of
tumors and the synthesis of amino acid derivatives
called opines which are exploited by the bacteria
(Binns & Campbell, 2001). e T-DNA is located
on the Ti plasmid (Tumor-inducing plasmid), which
also contains the vir genes that are necessary for the
transfer and incorporation of the DNA fragment into
the genome of the plant (Binns & Campbell, 2001;
Valderrama et al., 2005; Rodríguez, 2012).
However, to make this real, the rst step is to obtain
a cloning vector that allows the replication of the
gene of interest (CynD) and a transformation vector
containing a genetic construct, allowing expression
of the gene of interest in the plant (Gutarra, 2004;
Jiménez, 2014; Vázquez, 2016). Traditionally these
constructs have been developed using conventional
molecular biology techniques, however at present we
can make use of bioinformatic tools to perform the in
silico design of the genetic construct and contract the
synthesis thereof (Jiménez, 2014).
In the present project two bioinformatic tools like
SnapGene and ApE were used, the rst to download
the plasmids that were used, visualize the codons, show
in a linear and circular form the obtained plasmids and
the second to visualize the ORFs, select the restriction
enzymes and to design and visualize the primers.
e aim of this research was to design plasmids for
CynD expression in Arabidopsis thaliana (L.), Heynh.
mediated by A. tumefaciens.
MATERIALS AND METHODS
In this project we designed two types of plasmids that
allow the transfer of the CynD gene to Arabidopsis
thaliana, in order to lay the foundations to evaluate if
the transformation of this plant with this gene coding
for the enzyme cyanide dihydratase - which has the
property of cyanide detoxication - can confer on
plants the ability to grow in the presence of cyanide
and aid in its degradation.
is requires the design of a plasmid that acts as a
cloning vector to be able to replicate and obtain multiple
copies of the CynD isolated from B. pumilus, and
another plasmid that is used as a transformation vector
to transfer the CynD from A. tumefaciens to A. thaliana.
Modication of the coding sequence
First, it was determined which genetic sequence
was to be used for the construction of the plasmids.
e cyanide dihydratase (CynD) gene sequence of
B. pumilus strain C1 (1381pb), obtained from the
genebank of the National Biotechnology Information
Center (NCBI), was used. [Https://www.ncbi.nlm.
nih.gov/nuccore/AF492815.1]
e ApE v2.0.47 (A Plasmid Editor) program was used
to modify the coding sequence (ORFs determination,
introns removal, choice of enzymes and primer
construction), which is a free-access program that
allows the visualization of the coding region translation
and identication and display of restriction enzyme
sites within the DNA. Subsequently, the presence
of some signal peptide or transmembrane regions
in the gene was analyzed to avoid its presence in the
sequence. To do this, the tool we used was “Signal
Blast” of C.A.M.E. (Center of Applied Molecular
Engineering) [http://sigpep.services.came.sbg.ac.at/
signalblast.html].
Once the sequence of the gene of interest was modied,
restriction enzyme recognition sequences present in
the polylinker of each vector were placed at the ends of
the gen, with the condition that they don’t cut into any
part of the gene sequence. e restriction sites were
inserted using the Enzyme Selector function of the
APE software.
Revista Biotempo: ISSN Versión Impresa: 1992-2159; ISSN Versión electrónica: 2519-5697 Cuba et al.
192
Finally, it was veried that the inserted sites did not
run in the reading frame and when it nished, the nal
sequence was generated in FASTA format.
Design of cloning vector
e cloning vector was designed from the plasmid
pUC18 (Figure 1), which is characterized by having
many cloning sites and a selection gene (ampicillin
resistance).
Design of transformation vector for A. tumefaciens.
A. tumefacens is used as a vehicle for the genetic
transformation of plants. To do this, the bacterium
with its intact Ti plasmid is used as the vector, without
disassembly and another plasmid is inserted where the
gene of interest between T-DNA borders is found.
In this case, the transformation vector was designed
from the plasmid pBI121 (Figure 2), widely used for
the transformation of plants. For this, the sequence
e sequence of the plasmid was obtained from the
SnapGene bank [http://www.snapgene.com/resources/
plasmid_les/basic_cloning_vectors/pUC18/] and
using the ApE and SnapGene programs we analyzed
the enzymes to be used for insertion of the CynD
gene in the plasmid pUC18 and the sequences of the
primers. en, the CynD sequence was inserted in
silico in the plasmid pUC18, thereby obtaining the
cloning plasmid.
of the plasmid was obtained in the SnapGene bank
[http://www.snapgene.com/resources/plasmid_les/
plant_vectors/pBI121/] and we worked on the Ape
v2.0.47 program for the insertion of the gene Interest
therein by performing a simulation of the cut of the
plasmid at the conned site and a subsequent ligation
of the gene sequence prepared previously. e result
was displayed in the SnapGene® Viewer V 2.8.2
software.
Figure 1. Plasmid pUC18 obtained from SnapGene.
Figure 2. Plasmid pBI121 obtained from SnapGene.
Plasmid design for the expression of cynd in Arabidopsis
193
RESULTS
Modication of the coding sequence
e CynD gene sequence was obtained from the
NCBI gene bank (AF492815) and its ORF was
determined between 134 and 1192 nucleotides, the
remainder of the sequence was deleted. No signal
peptides or transmembrane regions were identied in
the sequence, using the Signal Blast tool of C.A.M.E.
For the insertion of CynD into the transformation
vector (plasmid pBI121) restriction enzyme
recognition sequences, ScaI (AGT’ACT) and BamHI
Design of cloning vector
With the ApE v2.0.47 software, the CynD gene
was inserted into the polylinker of plasmid pUC18
between the EcoRi (5’GAATTC - 3’CTTAAG) and
BamHi (5’GGATCC - 3 ‘CCTAGG) enzymes of the
multiple cloning site.
For the insertion of the CynD into the cloning vector
(plasmid pUC18), restriction enzyme recognition
sequences, BamHI (G’GATCC) and EcoRI
(G’AATTC) were placed at the gene ends, and the
forward primers and reverse were designed. (Table 1).
(G’GATCC), were placed at the gene ends, and the
forward primers and reverse were designed (Table 2).
e plasmid created: pUC18-CynD (Figure 3) also
contains an origin of replication encoding for the
initiation of DNA synthesis, an ampicillin resistance
gene as a selection agent and a bacterial lacZ gene
fragment as a metabolic marker (Louro & Crichton,
2013).
Table 1. Primers constructed to insert CynD into plasmid pUC18.
Primers sequences for inserting CynD into plasmid pUC18
Primer Forward AACGGATCCATGTCATCCAAACTTCATATTTCCT
Primer Reverse TGGTATACTGGAAGAAAAAGTTTAAGAATTCCCA
Table 2. Primers constructed to insert CynD into plasmid pBI121.
Primer sequences for inserting CynD into plasmid pBI121
Primer Forward AAAAGTACTATGTCATCCAAACTTCATATTTCCT
Primer Reverse TGGTATACTGGAAGAAAAAGTTTAAGGATCCCAA
Revista Biotempo: ISSN Versión Impresa: 1992-2159; ISSN Versión electrónica: 2519-5697 Cuba et al.
194
Design of transformation vector for A. tumefaciens
With the ApE v2.0.47 software, the CynD gene was
inserted into the polylinker of the plasmid pBI121,
between ScaI (5’GAGCTC - 3’CTCGAG) and
BamHI (5’GGATCC - 3’CCTAGG) enzymes.
e plasmid created: pBI121-CynD (Figure 4), also
contains a gene encoding the enzyme β-glucuronidase
from E. coli (GUS), a 35S promoter from the
cauliower mosaic virus (35SCaMV) and the NPTII
gene Neomycin phosphotransferase II, which confer
resistance to kanamycin in plants.
Figure 3. SnapGene diagram of cloning vector in after insertion of CynD.
Figure 4. SnapGene diagram of the transformation vector after insertion of CynD.
Plasmid design for the expression of cynd in Arabidopsis
195
DISCUSSION
e enzymes nitrilase, nitrilohydrate, cyanide
hydrate (CHT) and cyanide dihydratase or cyanidase
(CynD) are responsible for the degradation of CN
by microorganisms (Ebbs, 2010). Of these, cyanide
dihydrates readily convert cyanide into relatively
non-toxic products (formate and ammonia) and
does not require cofactors. So the gene encoding
this enzyme, CynD, from B. pumilus C1, has been
cloned, sequenced and being used in numerous genetic
engineering research.
In other studies, it was constructed vectors containing
CynD for the heterologous expression of these enzymes
in A. thaliana (Logan & Leaver, 2000). To do this, it was
used dierent plasmids compatible with the Gateway
cloning technology as the pENTRTMTOPO® vector
to clone the eector and a target vector pFAST,
which directs the constitutive expression of the
gene of interest under the control of the CaMV 35S
promoter (Shimada et al., 2010). In contrast, in this
project, we have designed two plasmids compatible
with traditional digestion technology by restriction
enzymes and ligases. As a cloning vector, pUC18 was
used as the base, which contains a bacterial lacZ gene
fragment that allows the simple identication of the
recombinant plasmids since it produces blue colonies
and if a DNA fragment is inserted into the polylinker,
this gene is inactivated giving rise to white colonies.
And as a transformation vector, pBI121, that contains
a gene encoding the enzyme β-glucuronidase from E.
coli (GUS), a CaMV 35M promoter and the NPTII
gene (neomycin phosphotransferase II) conferring
resistance to Kanamycin in plants.
For the design of plasmids and constructs, there are
several programs and web platforms such as Gene
Design 3.0 (Richardson et al., 2010), Gene Designer
2.0 (Villalobos et al., 2006), GeMS (Jayaraj et al., 2005),
Bioedit 7.2.5 (Hall, 1999), Visual Gene Developer 1.3
(Jung & McDonald, 2011), among others. In this project
we used the programs SnapGene and APE v2.0.47 (A
Plasmid Editor), due to the tools that they oer for the
visualization of the region of coding and identication
of restriction enzyme sites inside the plasmid and for
being programs of easy access.
It was possible to design two types of plasmids
that would allow the transfer of the gene CynD to
Arabidopsis thaliana via A. tumefaciens, achieving the
introduction of a metabolic pathway of synthetic
cyanide degradation from Bacillus pumilus, thus
allowing to increase the tolerance of the plant to CN
and with it, greater phytoremediation options.
e cloning vector (pUCCynD) was designed
by inserting in silico the CynD sequence in the
polylinker of the plasmid pUC18, between the EcoRi
(5’GAATTC-3’CTTAAG) and BamHi (5’GGATCC-
3’CCTAGG) enzymes of the multiple cloning site.
e transformation vector (pBCynD) was designed by
inserting in silico the CynD sequence in the polylinker
of the plasmid pBI121, between the enzymes ScaI
(5’GAGCTC - 3’CTCGAG) and BamHI (5’GGATCC
- 3’CCTAGG).
BIBLIOGRAPHIC REFERENCES
Binns, A. & Campbell, A. 2001. Agrobacterium
tumefaciens-mediated transformation of Plant
cells. Els-Encyclopedia of life sciences. 1-6.
Donato, D.B.; Nichols, O.; Possinghamc, H.; Moore,
M.; Ricci, P.F. & Noller, B.N. 2007. A critical
review of the eects of gold cyanide-bearing
tailings solutions on wildlife. Environment
International, 33: 974–984.
Ebbs, S. 2010. Biological degradation of cyanide
compounds. Current Opinion in
Biotechnology, 15: 231-236.
Echenique, V. 2004. Biotecnología y mejoramiento
vegetal. Instituto Nacional de Tecnología
Agropecuaria: Buenos Aires, Argentina. pp.
148.
Garnkel, D.J; Simpson, R.B.; Ream, L.W.; White, F.F.;
Gordon, M.P. & Nester, E.W. 1981. Genetic
analysis of crown gall: ne structure map of
the T-DNA by site-directed mutagenesis.
Cell, 27: 143-153.
Gong, J.S.; Lu, Z.M.; Li, H.; Shi, J.S.; Zhou, Z.M.
& Xu. Z.H. 2012. Nitrilases in nitrile
biocatalysis: recent progress and forthcoming
research. Microbial Cell Factories, 11: 1-8.
Gutarra, B.A. 2004. Construcción de dos vectores conte-
niendo un gen inhibidor de tripsina unido al pro-
Revista Biotempo: ISSN Versión Impresa: 1992-2159; ISSN Versión electrónica: 2519-5697 Cuba et al.
196
motor de la β- amilasa y agro-transformación de
camote (Ipomoea batatas Lam.). Tesis para optar
el Título Profesional de Biólogo con Mención
en Genética. Universidad Nacional Mayor de
San Marcos. Facultad de Ciencias Biológicas.
Hall, T.A. 1999. BioEdit: a user-friendly biological
sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic
Acids Symposium Series, 41: 95-98.
Jayaraj, S.; Reid, R. & Santi, D.V. 2005. GeMS: an
advanced software package for designing
synthetic genes. Nucleic Acids Research,
3011–3016.
Jiménez J. 2014. Diseño de genes semi-sintéticos que
coneran tolerancia a herbicidas en soya.
Magister en Ciencias-Biología. Facultad
de Ciencias-Departamento de Biología.
Colombia.
Jung, S.K. & McDonald, K. 2011. Visual
gene developer: A fully programmable
bioinformatics software for synthetic gene
optimization. BMC Bioinformatics, 12: 1-13.
Kebeish, R.; Aboelmy, M.; El-Naggar, A.; El-Ayouty,
Y. & Peterhansel, C. 2015. Simultaneous
overexpression of cyanidase and formate
dehydrogenase in Arabidopsis thaliana
chloroplasts enhanced cyanide metabolism
and cyanide tolerance. Environmental and
Experimental, 110: 19-26.
Logan, D.C. & Leaver, C.J. 2000. Mitochondria-
targeted GFP highlights the heterogeneity
of mitochondrial shape, size and movement
within living plant cells. e Journal of
Experimental Botany, 51: 865-871.
Louro, R.O. & Crichton, R.R. 2013. Practical
approaches to biological inorganic chemistry. 1st
edn, Elsevier: Amsterdam, Oxford. 279.
Molojwane, E. 2015. Engineering cyanide-tolerant
Arabidopsis thaliana. Master’s thesis,
University of Cape Town, South Africa.
Richardson, S.M.; Nunley, P.W.; Yarrington, R.M.;
Boeke, J.D. & Bader, J.S. 2010. GeneDesign
3.0 is an updated synthetic biology toolkit.
Nucleic Acids Research, 38: 2603–2606.
Rodríguez, L. 2012. Acercamiento al estudio del
comportamiento biológico de Agrobacterium
tumefaciens. Título de Especialista en
Biotecnología Agraria. Escuela de ciencias
agrícolas, pecuarias y del medio ambiente,
Bogotá.
Shimada, T.L.; Shimada, T. & Hara-Nishimura, I.
2010. A rapid and non-destructive screenable
marker, FAST, for identifying transformed
seeds of Arabidopsis thaliana. e Plant
Journal, 61: 519-528.
Valderrama, A.; Arango, R. & Afanador, L. 2005.
Transformación de plantas mediada por
Agrobacterium:” Ingeniería genética natural
aplicada”. Revista Facultad Nacional De
Agronomía, Medellín, 58: 2569-2585.
Vargas, J. 2017. Estudio ambiental y optimización en
la extracción del oro utilizando el cianuro.
Revista Ciencia y Desarrollo, 10: 75-80.
Vasil’ev, L.A.; Vorobyov, A.A.; Dzyubinskaya, E.V.;
Nesov, A.V.; Shestak, A.A. & Samuilov, V.D.
2007. Cyanide-Induced death of cells in plant
leaves. Biochemistry, 72, 572–577.
Vázquez, X. 2016. Análisis bioinformático de la secuencia
de un plásmido de resistencia-virulencia de
Salmonella enterica obtenida por técnicas de
primera, segunda y tercera generación. Master
universitario en Biotecnología Alimentaria.
Universidad de Oviedo. España.
Villalobos, A.; Ness, J.; Gustafsson, C.; Minshull, J.
& Govindarajan, S. 2006. Gene Designer: a
synthetic biology tool for constructing articial
DNA segments. BMC Bioinformatics, 7: 1-8.
Zambryski, P.; Joos, H.; Genetello, C.; Leemans,
J.; Van Montagu, M. & Schell, J. 1983. Ti
plasmid vector for the introduction of DNA
into plant cells without alteration of their
normal regeneration capacity. e EMBO
Journal, 2: 2143-2150.
Received September 14, 2017.
Accepted November 16, 2017.
